The role of TFIID in the transcriptional control of the human cPLA2 gene


×
Rating : Rate It:
 
Embed :   
 
twinkle rose    on May 29, 2012 Says :

thanks
Post a comment
    Post Comment on Twitter
Comments:  



  Notes
 
 
Slide 1 : TFIID mediated control of the human cytosolic phospholipase A2 gene Mark J. Cowan, M.D. Division of Pulmonary and Critical Care Medicine The University of Maryland
Slide 2 : Arachidonate Metabolism Generation of paracrine acting lipid mediators Intracellular second messengers
Slide 3 : Airway epithelial cell response to inflammation Primary responses Amplification of the inflammatory response Modulation of the inflammatory response
Slide 4 : Regulation of Airway Inflammation Initiation Amplification Modulation Propagation
Slide 5 : Cellular Response to Inflammatory Stimuli Primary Cellular Responses Secretion Physical Changes Amplification of the Inflammatory Response Cytokine Mediators Lipid Mediators Receptor Expression Modulation of the Inflammatory Response Receptor blockers Receptor Shedding Down Regulation of Cellular Responses
Slide 6 : Phospholipases R2 PLA2 PLA1 R1 O P Base O PLC PLD DAGL O C O C O O O O
Slide 7 : Phospholipases and AA Metabolism PLA2 R1 O P Base O O C O O O O AA PGs HETEs LTs L.O. COX PAF TXs EPOs Mono Memb.
Slide 8 : IFN-g IL-1 TNF IL-4 IL-13 Epithelial Cell Responses IFN-g TNF IL-1 IL-2 IL-4 IL-6 PAF PGE2 15 HETE PGF2a PGE2 PAF IL-6 IL-8 CSFs ICAM-1 Endothelin cPLA2 AA PGE2 CCSP sTNF-R IL-1RA NEP Initiation Amplification Modulation IL-6 IL-8 IL-11 GM-CSF INF Cells
Slide :
Slide 10 : cPLA2 gene elements I >25,000 1 136 II >15,000 2 102 III >8,000 3 82 IV 1,000 4 159 V 13,000 5 114 VI 4,400 6 38 VII 8,500 7 142 VIII 6,000 8 137 IX 1,000 9 223 X 6,000 10 115 XI 300 11 138 XII 3,700 12 93 XIII 4,800 13 72 XIV 15,000 14 243 XV 13,000 15 185 XVI 1,800 16 196 XVII 9,400 17 158 18 612 Intron Exon Length (bp) Length (bp)
Slide 11 : cPLA2 gene structure Introns-17 for 139 kbp Exons-18 for 2945 bp ATG TAG
Slide 12 : Cellular Arachidonate Metabolism Extracellular Space Cytosol Nucleus cPLA2 sPLA2 CCSP p11 AA AA L.O. Cox DNA Binding Proteins IFN-g TNF-a LIF
Slide 13 : 3D structure of human cPLA2 Dessen et. al. Cell 1999, 97:349-360
Slide 14 : Phospholipases R2 PLA2 PLA1 R1 O P Base O PLC PLD DAGL O C O C O O O O
Slide 15 : Phospholipase A2 Calcium Dependent Source Ca++ Group IB sPLA2 Pancreatic mM Group IIA sPLA2 Synovial, Plts. mM Group IIC sPLA2 Testes mM Group V sPLA2 Macrophages mM Group X sPLA2 PMNs mM Group IV cPLA2 Most cells
Slide 16 : Calcium Independent iPLA2 Type kDa Organ Group IV C cytosolic 65 Heart, Muscle Group VI cytosolic 85 Macrophages Group VII A secreted 45 Human Plasma Group VII B cytosolic 42 Brain Group VIII cytosolic 29 Brain
Slide 17 : cPLA2 Family Ca Dep. AA Sel. PLA2 PLA1 cPLA2a Yes Yes Yes No cPLA2b Yes No Yes Yes cPLA2g No No Yes Yes
Slide 18 : cPLA2 Family cPLA2 a b g CaLB Catal. A Catal. B S S S S 437 454 505 727 T 330 S 228 D 549 Song, JBC, 1999
Slide 19 : Cytosolic Phospholipase A2 N C Leslie, JBC, 272:16710 Mosior, JBC, 273:2184 Wu, JBC, 272:17145 Gijon, JCB, 145:1219 Nakatani, JBC, 275:1161 S727 S505 S437 S454 MAPK D549* R200 S228* C331 ?PKC C.B.D. P.H.D. PI(4,5)P2 300 350 PKA 178 749 T330* D43 P11 Vimentin GLSGS GXSXS
Slide 20 : cPLA2 mRNA 2836 ATAAA 2385 139 2247 bases 749 AAs 2876 AUUUA 2453 2714 2774 2806 5’UTR 138 bases 3’UTR 491 bases
Slide 21 : DNA Footprinting Formic Acid/ Piperidine G/A Ladder DNase Nuclear Protein - + FA NP DNase Sequencing Gel
Slide 22 : Electrophoretic Mobility Shift Assay DS DNA Nuclear Protein Antibody + + Autoradiograph of Acrylamide Gel
Slide 23 : Cytosolic Phospholipase A2 Overview Intracellular enzyme, present in most cells Activated by a variety of physiologic stimuli (Ca+2, MAPKinase, PIP) Arachidonate selective Responsible for stimulated AA release cPLA2 knockout animals
Slide 24 : Pulmonary Effects of Lipid Mediators Product Perm. SMT Inf. Cell Secret. PGD2,E2,I2 PGF2? TXA2 LTB4 LTC4,D4 5-HETE 15-HETE PAF
Slide 25 : cPLA2 Deficient Mice Reduced fertility Reduced postischemic injury Reduced macrophage production of AA, PGE2, LTB4, LTC4, PAF Reduced airway response to OVA Reduced airway response to methacholine Uozumi et al, and Bonventre et al. Nature, 1997
Slide 26 : Effect of Lipid Mediators on Airway Secretion Mediator Generated by Effect on Airway Cells Secretion PGE2 ++ PGF2? + 5-HETE + 12-HETE + 15-HETE ++ LTC4/D4 PAF +
Slide 27 : Activation of cPLA2 activity Enzyme activation IFN-g, TNF-a, IL-1a, IL-1b, LIF, M-CSF, EGF Thrombin, Ca+2, PI(4,5)P2 Serine phosphorylation G-protein signaling Induction of gene expression IFN-g, TNF-a, IL-1a, IL-1b, EGF
Slide 28 : Inhibition of cPLA2 activity PGE2 activation of PKA and inhibition of MAP kinase Induction of p11 and binding to cPLA2 Other feedback loops related to AA release Inhibition of cPLA2 gene expression
Slide 29 : Human cPLA2 promoter CA repeat OCT GRE g-IRE g-IRE g-IRE OCT GRE g-IRE CAAT GAS g-IRE +1 -595 TSS
Slide 30 : cPLA2: 5’ Promoter Sequence -1310 -1264 AAATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT -257 -221 GA--//--CACACACACACACACACACACACACATCACACACACAGAAA TCCACAACAGCACTCATGGAATTTAGGACTGATTAATTTACA--//--C -40 -30 ACCTTAAAACATCTGCAAAAGCGCAAGGAGACCAGCCCACATTTTAGCC +1 CCTCCTACTCAGGATAAGACTTTCTCTAAGTCCGGAGCTGAAAAAGGAT +82 CCTGACTGAAAGCTAGAGGCATTGAGGAGCCTGAAGATTCTCAGgta
Slide 31 : Core Promoter Motifs TATA box ~30 bases upstream of the TSS TFIIB recognition element (BRE) 5’ of TATA element (G/C)(G/C)(G/A)CGCC Initiator elements Span the TSS Downstream promoter element (DPE) ~30 bases downstream of the TSS (A/G)G(A/T)CGTG
Slide 32 : TATAA-less initiator sequences GCCCTCATTCTGGAGAC GTCCTCACTCTCTTCCG ATTTCGCGCCAAACTT CANNNTCCTGGTT CTTCCCTTTTCC CTCAGTCT CTCCATTTT CTACTCAGGATAAGACT TdT AdML DHFR PBGD RPI C1 inh P5 cPLA2
Slide 33 : Luc Luc Luc Luc 595Luc 485Luc 290Luc 149Luc 595bp 485bp 290bp 149bp +77 +77 +77 +77 +1 +1 +1 Deletion constructs +1
Slide 34 : cPLA2 Promoter Activity 0 -290 -458 -595 -595r -149 10 20 30 40 50 60 Reporter Constructs Relative Luciferase Activity
Slide 35 : Generation of reporter constructs Template: Human cPLA2 clone (Tong Wu) PCR with missense mutations within primers to generate mutations and deletions, as well as Sac I and Nhe I restriction sites Cloned into TA cloning vector (Invitrogen) and sequenced Subcloned into PGL-2 or -3 (Promega) and re-sequenced
Slide 36 : cPLA2 Initiator TCAAACTCCTGGTTCTAATAACTAAGCATTTACATTTACAAT ATTAGCTTCTATGAGAAGAGAGCGTTCTCCCTCTTCCCCTTT AATTCCACCTTAAAACATCTGCAAAAGCGCAAGGAGACCAGC CCACATTTTAGCCCCTCCTACTCAGGATAAGACTTTCTCTAA GTCCGGAGCTGAAAAAGGATCCTGACTGAAAGCTAGAGGCAT TGAGGAGCCTGAAGATTCTCAGgtaactct +1 -149 +92
Slide 37 : Luc+ Luc+ Luc+ 149Luc+ 138Luc+ 123Luc+ 149bp 138bp 123bp +92 +92 +92 +1 +1 Deletion constructs +1 Luc+ 73Luc+ 73bp +92 +1 Luc+ 31Luc+ 31bp +92 +1
Slide 38 : Reporter gene assay 2 mg of plasmid, 0.01 mg pCMV-SEAP (Tropix) to 6-well plates of BEAS-2B or HeLa cells with lipofectamine reagent (Gibco-BRL) for 2-4 hours Incubated 24 hours and supernatant SEAP assayed utilizing Tropix system Cell lysate luciferase assayed utilizing Promega chemiluminescence system
Slide 39 : % luciferase activity +6+92 -6+92 -31+92 -73+92 -123+92 -138+92 -149+92 Deletion constructs Mean n=30 n=17 n=14 n=14 n=22 n=10 n=14
Slide 40 : % luciferase activity -149-6 -149+92 10b- +92-149 -149+92 Inversion and TSS deletion constructs Mean n=30 n=5 n=5 n=4
Slide 41 : % luciferase activity -149+92 -2-3+2+3 -149+92 +2+3 -149+92 -1+1 -149+92 -2-3 -149+92 Initiator mutation constructs Mean n=30 n=9 n=9 n=3 n=12
Slide 42 : Electophoretic mobility shift assay Synthesis of complementary oligonucleotide pairs on Beckman 1000M DNA synthesizer End labelled with T4 PNK (Boehringer) and g-P32 ATP (Amersham) Incubated with binding buffer and HeLa nuclear extract (Promega) Run on 6% 0.5X TBE PAGE (Novex) and developed with Kodak BioMax-MR film
Slide 43 : cPLA2 Initiator GCAAAAGCGCAAGGAGACCAG CCCACATTTTAGCCCCTCCTA CTCAGGATAAGACTTTCTCTA -45 -25 +1
Slide 44 : 4525* 4525*+HeLa 4525*+HeLa+4525 4525*+HeLa+RND12
Slide 45 : 4525* 4525*+HeLa 4525*+HeLa+4525 4525*+HeLa+TFIIDcon 4525*+HeLa+RND12
Slide 46 : “Southwestern” blot procedure EMSA done, and developed onto film 6% 0.5X TBE gel blotted onto nitrocellulose utilizing Novex system Blocked in milk and developed with mouse anti-human TFIID, followed by goat anti-mouse HRP conjugated antibody (ECL system-Amersham)
Slide 47 : Western Blot a-TBP antibody Electrophoretic mobility shift assay 4525* 4525*+HeLa 4525* 4525*+HeLa
Slide 48 : 4525* 4525*+HeLa 4525*+Hela+1:10 06241 4525*+HeLa+1:1 06241
Slide 49 : 4525*+Hela+2535 4525*+HeLa 4525*+Hela+3040 4525*+Hela+3545
Slide 50 : 4525*+Hela+2535 4525*+HeLa 4525*+Hela+3040 4525*+Hela+3545 4525*+HeLa
Slide 51 : 4525d3035*+Hela 4525*+HeLa
Slide 52 : Conclusions The cPLA2 promoter lacks a TATAA box, but TFIID specifically binds to an AAGGAG motif at -30 to -35. The cPLA2 promoter contains an initiator element at the transcription start site. Bases -2-3 and to a lesser extent +2+3 are important in transcriptional activity Deletion of -5 to +5 abolishes activity
Slide 53 : Collaborators X. Yao, MD T. Wu, MD, PhD C. William Angus, PhD Carol Logun, MS Eric Libré Pat Madara, MS James H. Shelhamer, MD

 



Related 

 
Free Powerpoint Templates
Add as Friend mcowan@medicine.umaryland.edu     5 Years ago.
402 Views, 0 favourite
PowerPoint Presentation on The role of TFIID in the transcriptional control of the human cPLA2 gene    more
More By User

Flag as inappropriate





Browse | Powerpoint Templates | Tags | Contact | About Us | Privacy | FAQ | Blog

© Slideworld